This assignment is due at the beginning of your discussion section on Wednesday, November 12. Unlike previous assignments, this one requires some open-ended experimentation in the labs, so don't expect to be able to complete it in one sitting.

Summary: In this assignment you will gain familiarity different tools for creating, editing, and storing images and with applying compression techniques and understanding their effects.

(a) The lab machines provide these three tools for image manipulation:

   * The drawing layer in Microsoft Word
   * Paint (in the Accessories menu)
   * Microsoft Photo Editor (in the Office Suite) or Iview image editor (the labs will have one or the other)

Spend some time familiarizing yourself with each of these tools, getting answers to the questions below. Remember that the main point is finding the answer, not the answer itself. You won't get much from the assignment if you let someone else do the work.

Most people who become experts at using a particular application program get their expertise through experience, not (primarily) by reading the documentation. Moreover, that experience comes not only from working on specific tasks but also from experimentation, or "playing around"--trying different commands or actions to see what results. You should take this opportunity to do the same.

1. Which tool(s) do vector (line) graphics? Which edit bitmaps?



2. What graphics file formats (GIF, JPEG, BMP, etc.) do these tools read? (Check the "Open" dialog or the "Import" command.) Which do they write? (Check "Save As" or "Export".)



3. Create one or two images of some complexity using each tool (or read images, e.g., from the Web, if the tool doesn't allow creation of new images). Spend some time trying out the menus and buttons to see what they do, and make a note of the most useful or interesting features (which will probably be different in the different tools).



4. How big is each of these images when you save it in the tool's default format? How does the size change if you choose other resolutions, other bit depths, and other file formats? What's the smallest size at which you can save your image without losing noticeable quality? What's the smallest size that may lose quality but still keeps the image recognizable? Are these results what you expect, given your knowledge of image representation, or were there surprising results?



5. What happens when you copy an image from one tool and paste it into another? Are there things you can do to the image in the second tool that you can't in the original tool, or vice versa?



6. Can the second tool save the image as a significantly smaller file (and if so, is any noticeable quality lost)?

The main goal of this lab is to give you enough experience with these tools to appreciate the ways you might use them. Don't short-change the time you spend exploring and experimenting. Your answers to the questions above don't have to be long, but they should be complete enough to show you've spent some time. Printed illustrations will be helpful. You'll submit this on paper, clearly marked "part (a)."

(b) Below is a cryptogram from the Saturday Review. Your job is to decode it back into the original English message. Feel free to work on this in groups of two or three. However, if you have past experience solving cryptograms, please work by yourself; otherwise, the experienced person will overwhelm everyone else in the group.

A cryptogram is a message or quotation written in a substitution cipher--for each letter in the original message, a different letter has been uniformly substituted in the cryptogram.

Here's a hint for working in groups: Everyone should work on the same copy of this sheet at once. That way, if you want to start over you can use a new, clean worksheet.

BSL PLXB NFIB CR BSL RDEBDCV DV JFVA VCYLUX DX BSL VCBDEL BSFB BSL ESFIFEBLIX FIL NHILUA DJFKDVFIA. -- RIFVOUDV N. FTFJX

Now, ask yourself: What property of natural language do cryptograms illustrate? Print your solution to the cryptogram and the one-word answer to this question, both clearly marked "part (b)."

(c) In class we discussed delta encoding. Here you will perform delta encoding on two sequences and calculate their compression ratios. You will also plot the two sequences in a line graph and write a paragraph or two describing your results. In addition, you will compress one of the sequences by varying the quantization (i.e., by using fewer digits of precision), again plotting and commenting on the results.

(c.1) First, download the file http://www.ics.uci.edu/~kay/courses/10a/hw/CompressionMaster.xls . Then open the file in Excel.

Follow the instructions in the file for identifying the two columns of data you will work with. (Everyone gets different data, depending on their student ID; use the correct set or you won't get credit.)

Create a new spreadsheet with your name and other identifying information. Copy into that spreadsheet your own two columns of data from the CompressionMaster spreadsheet. Mark those columns "Original Data A" and "Original Data B."

(c.2) Do these three steps for both A and B:

-- In an adjacent column, produce a delta-encoded version of the sequence (i.e., compute just the differences between each item and its predecessor). (Selecting the cells in the new column and using "Fill Down" from the Edit menu will save you from having to type repetitively similar formulas.)

-- Calculate the compression rate (the number of ASCII symbols in the compressed data divided by the number of ASCII symbols in the uncompressed data). (Cutting and pasting to use "Word Count" from the "Tools" menu of Microsoft Word is better than counting by hand.)

-- Plot a chart of the sequence, using a line graph with no markers. Be sure to include an appropriate heading.

(c.3) Now, do this additional task, just for the A data: Create a new column, dividing each value by 1000. (The original data was in millimeters; your new column is in meters.) This new column will have three digits to the right of the decimal point. To vary the quantization, create three more columns: One with two digits to the right, one with one digit to the right, and one with no digits to the right of the decimal point. The Round function helps here.

As before, calculate the compression rates for each of the three reduced-precision columns. Then produce a bar graph showing the relative sizes of the four representations.

Next, plot the original data (in meters) against each of the three reduced-precision versions (i.e., produce three plots). Be sure to label the graphs appropriately.

(c.4) Finally, write a couple of paragraphs describing your results. What you write should provide answers and explanations to the following questions, at least: Did both sequences compress equally well using delta encoding? Could you have predicted the results from looking at the graphs? How much reduction of precision was possible before the quality of the data degraded significantly (i.e., at what point could you detect a difference between the original and compressed data)?

Print these answers, marking them clearly "part (c)."

(d) The class and the text describe run-length encoding (RLE). Find three images of flags on the Web: one that will compress very well using RLE, one that will compress very poorly using RLE, and one in the middle. Justify your choices in a few brief sentences (i.e., say why the good one's good, and so on). (Hint: The study of flags is called vexillology, so using that as a search term will point to lots of flag images.) Download the images from the Web and place them in your report, adjusting them so they're uniformly sized and neatly aligned. (The graphics tools from the first part of this assignment should help.) Mark this all "part (d)."

(e) Below are three images. Image A is the original; the other two are compressed using lossy techniques. One used a reduced quantization; the other used coarser sampling. Which is which (with a sentence explaining your answer)? Print it and mark it as usual.

(f) Below are three more images. Which would compress best using delta encoding? Which would compress worst? Again, justify your answer in a sentence or two, printed out and marked "part (f)."

(g) Select a pair of DNA strings from the list below. (Be sure to select the correct pair according to the instructions, or you won't get credit.) Compress the two strings using run-length encoding and calculate the compression rates, showing your work fully. Then describe in a couple of sentences why the strings didn't compress equally well (i.e., what is it about one string that made it more amenable to compression than the other?). Print and mark this part, too.

If the first digit of your student ID is 0, compress the following two DNA strings:

1) ACGGGGGGGGGGGGGGGGGCCCCCCCCCCGGGGGGGGGGGGGGGGGGGGG
2) AAGGGGGGAAGAGTATGGAGTAAGGGATTGGGCACCCCGTCCCGGTCGCA

If the first digit of your student ID is 1, compress the following two DNA strings:

1) GGGGGGGAAAAAACCCCCCCCCGGGGGGGGGGGGGGGGGGGTAAAAAAAA
2) TTAAGGGTTTATATGTTTTTAAACACCGGCATTTAACCAACCCGTTTTAA

If the first digit of your student ID is 2, compress the following two DNA strings:

1) AAAAATTTTTTTTTAAAAAATTTTGGTTTTTCCCCCCCCCTAATTTTTTT
2) AAGATTGTACCGGAAAAAACCAGTTTTTGGCCCGTTCTTATATTTCGCTA

If the first digit of your student ID is 3, compress the following two DNA strings:

1) TTTTGGGGGGGGGGGGGGGGAAAAAAAAAAAGGGGGGGGGGGGGGGGGGG
2) TAATTTGCGTCCAGAGCCGTGCAGGCAACGGGGAAACCTCGGTTTTCTTA

If the first digit of your student ID is 4, compress the following two DNA strings:

1) TTTTTTTTTTTTTTTTTTGGGGGGGGGGGGGAAAAAAAAAAAAAAAAAAT
2) GCCCCAATAAAAATTCTCCCCTCCAAGCGTTTAGCGGCCAAACCTCAAAA

If the first digit of your student ID is 5, compress the following two DNA strings:

1) AAGGGGGGGGGGGGGGCCCCCCCCCCCGGGGGGTTTAATTTTTTTTTTTA
2) GAGGACAAGCGCCTTTTTGGAGGGAAGGGGCGCAAACCGGGTGGGCGTGC

If the first digit of your student ID is 6, compress the following two DNA strings:

1) CCCGGGGGGGGGGTTTTAAAAAACCCCCCCTTAAAAAAAAAATTTTTTTT
2) CAGCCGCCCTGGCATACGGCCGGACAATTTGTTTTTAAGCCTCCCTTAAA

If the first digit of your student ID is 7, compress the following two DNA strings:

1) CCCCCCCGGGGGGGGGGGGGGGCCCCCTTTTTTTTTTTTTTTTGGGGGGG
2) CCCTTTAGCGTTCCCTATTCCGCCCATAGAAATACAAACTTTCTAGATAC

If the first digit of your student ID is 8, compress the following two DNA strings:

1) CCCCCAAAAAAAAAAAAAAAAAAAAAAAAAATTTCCCGGGGGGGGGAAAA
2) CATGGCGCTGGAACCCCCAAAAAAGGTTTCTTTTTCCAAAGTTCTCAAAG

If the first digit of your student ID is 9, compress the following two DNA strings:

1) AAAAAGACCCAAAAAAAAAAAAAAAAAGGGGGGGTTTTTTTTTTTTTGGG
2) CTTCAAAAAAACGGGGGATGAAATTTTTTCTAGTCCCTTGCCGGGGAGTT

(h) (extra credit) As we showed in class, LZW compression finds previously occurring portions of a text and, rather than spelling them out again fully, includes a (shorter) reference to the portion's first occurrence. Thus, "Mississippi" could be compressed to "Miss[2,3]ippi" (without compressing single-letter pieces). Another way to represent this same kind of compression is with a dictionary:

   # iss (This single-entry dictionary says to substitute "iss" for the shorter "#")

   M##ippi

Even the above short example saves one character if we ignore white space. If we do the same with "Hodgepodge," we save even more since the dictionary would contain the one entry "# odge " and the word itself contains just the characters "H#p#"; this would be a compression rate of 0.9, since the dictionary plus the word take up 9 characters (ignoring white space) while the original word took up 10.

Here, then is the task: Find an English word with a better compression ratio (using this method) than 0.9. You're allowed to have multiple entries in the dictionary; that might help in some cases. We'll share the best ones in class. (For a slightly easier task, find a short English sentence that has a better compression ratio than 0.9.)

Written by David G. Kay, Summer 1999; revised Fall 1999, Fall 2000, Fall 2001, and Fall 2003.

Compression exercises written by Eamonn Keough and David G. Kay, Summer 1999; revised Fall 1999, Fall 2000, Fall 2001, and Fall 2003.

Wednesday, November 5, 2003 -- 8:26 AM